1 1

Hsa-miR-146a-5p mimic

Hsa-miR-146a-5p mimic

Size

QM-0171123-01

£188.51 GBP
Sale Sold out

Request quote or documents

View full details

Product Details

  • Description

    Hsa-miR-146a-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.

  • Molecular Weight

    13943.4

  • Smiles

    [hsa-miR-146a-5pmimic]

  • Target

    MicroRNA

  • Purity

    98.4

  • Solubility

    H2O

  • Storage Conditions

    -20°C (Powder, sealed storage, away from moisture)

  • Shipping Conditions

    Blue Ice
Learn more
Variant Variant total Quantity Price Variant total
5 nmolQM-0171123-01
5 nmolQM-0171123-01
£188.51/ea		 £0.00
£188.51/ea £0.00
20 nmolQM-0171123-02
20 nmolQM-0171123-02
£351.32/ea		 £0.00
£351.32/ea £0.00
View cart
0

Total items

£0.00

Product subtotal

Taxes, discounts and shipping calculated at checkout.
View cart

Related Products

Other industry favorites

Hsa-miR-146a-5p mimic

Hsa-miR-146a-5p Mimic for MicroRNA Functional Research

Hsa-miR-146a-5p mimic is a chemically synthesized double-stranded RNA reagent used to model up-regulation of endogenous hsa-miR-146a-5p activity in laboratory microRNA workflows.

Research context: hsa-miR-146a-5p is a human mature microRNA associated with MIR146A. miRNA mimics are commonly used in gain-of-function experimental designs where researchers introduce a synthetic RNA duplex to increase miRNA-like activity in cells or assay systems.
Product identity Hsa-miR-146a-5p mimic
miRNA reference hsa-miR-146a-5p; miRBase MIMAT0000449
Mature sequence UGAGAACUGAAUUCCAUGGGUU
CAS number Not stated on the product page
Application field MicroRNA functional analysis and RNA biology research
Handling note Use nuclease-free technique; confirm batch-specific SDS and CoA before use

Search terms and entity terms

Hsa-miR-146a-5p mimic miR-146a-5p mimic MIMAT0000449 MIR146A microRNA mimic miRNA gain-of-function RNA biology reagent human mature miRNA

How researchers use this compound

  • Used in miRNA gain-of-function workflows to study the effect of increased hsa-miR-146a-5p-like activity.
  • Applied in cell-based research designs comparing mimic-treated samples with negative-control mimic conditions.
  • Relevant for RNA biology, pathway-profiling, gene-expression, inflammatory-response, and disease-model research workflows.
  • Used alongside qPCR, reporter assays, transcript analysis, or protein readouts when validating miRNA-associated phenotypes.
Avoid interpreting mimic data as direct mechanism evidence without appropriate controls, dose optimization, time-course design, and orthogonal validation.

Selection notes for laboratory teams

  • Select the amount and formulation according to transfection scale, cell type, assay endpoint, and replicate plan.
  • Use RNase-free consumables, nuclease-free water or validated buffer, and optimized transfection conditions.
  • Include negative-control mimic, mock-transfection, and, where relevant, rescue or inhibitor controls.
  • Confirm the supplied molecular weight, purity, storage temperature, and reconstitution instructions against the product CoA.
  • No verified hazard or precautionary phrases are provided here; confirm against batch-specific SDS before handling.

Neutral reference sources

FAQ

What is Hsa-miR-146a-5p mimic used for?

Hsa-miR-146a-5p mimic is used in laboratory microRNA gain-of-function workflows to model increased hsa-miR-146a-5p activity.

What is the CAS number of Hsa-miR-146a-5p mimic?

No CAS number is stated on the QuantiMol product page. Use the product name and miRNA identifier MIMAT0000449 for identity reference.

What is the molecular formula of Hsa-miR-146a-5p mimic?

A molecular formula is not stated on the visible product page. Confirm molecular composition against the batch-specific CoA.

What is the mature hsa-miR-146a-5p sequence?

The mature hsa-miR-146a-5p sequence is UGAGAACUGAAUUCCAUGGGUU, referenced by miRBase accession MIMAT0000449.

Is Hsa-miR-146a-5p mimic a small molecule?

No. It is a synthetic RNA mimic reagent designed to imitate a human mature microRNA sequence in research workflows.

How should Hsa-miR-146a-5p mimic be stored?

The visible QuantiMol page lists -20°C storage for sealed powder away from moisture. Confirm final storage instructions on the CoA or SDS.

Is Hsa-miR-146a-5p mimic for research use only?

Yes. It is supplied for laboratory research use only and is not intended for human, veterinary, food, drug, or household use.

For laboratory research use only. Not for human, veterinary, food, drug, or household use.