Skip to product information
1 of 1

Tau ASO-12 (murine) (sodium)

Tau ASO-12 (murine) (sodium)

Size

SKU:QM-0144062-01

£88.00 GBP
Sale Sold out
Quantity

Request quote or documents

View full details
  • Description

    TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ [1])

  • Molecular Weight

    7619

  • Smiles

    [TauASO-12(murine)(sodium)]

  • Target

    Tau Protein

  • Purity

    97.18

  • Solubility

    10 mM in H2O

  • Storage Conditions

    4°C (Powder, sealed storage, away from moisture)

  • Shipping Conditions

    Room Temperature

Your cart
Variant Variant total Quantity Price Variant total
1 mgQM-0144062-01
1 mgQM-0144062-01
£88.00/ea
£0.00
£88.00/ea £0.00
5 mgQM-0144062-02
5 mgQM-0144062-02
£233.47/ea
£0.00
£233.47/ea £0.00
10 mgQM-0144062-03
10 mgQM-0144062-03
£333.10/ea
£0.00
£333.10/ea £0.00

View cart
0

Total items

£0.00

Product subtotal

Taxes, discounts and shipping calculated at checkout.
View cart

Tau ASO-12 (murine) (sodium)

Tau ASO-12 (murine) (sodium) is a premium-grade research compound supplied by Quantimol for laboratory and scientific applications.